Review



plasmid supernova/prsetb  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc plasmid supernova/prsetb
    Plasmid Supernova/Prsetb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid supernova/prsetb/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plasmid supernova/prsetb - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    90
    Addgene inc plasmid supernova/prsetb
    Plasmid Supernova/Prsetb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid supernova/prsetb/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plasmid supernova/prsetb - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    91
    Addgene inc plasmid supernova prsetb
    Plasmid Supernova Prsetb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid supernova prsetb/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    plasmid supernova prsetb - by Bioz Stars, 2026-03
    91/100 stars
      Buy from Supplier

    91
    Addgene inc supernova prsetb
    Supernova Prsetb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/supernova prsetb/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    supernova prsetb - by Bioz Stars, 2026-03
    91/100 stars
      Buy from Supplier

    91
    Addgene inc supernova
    Supernova, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/supernova/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    supernova - by Bioz Stars, 2026-03
    91/100 stars
      Buy from Supplier

    91
    Addgene inc prsetb supernova
    Prsetb Supernova, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prsetb supernova/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    prsetb supernova - by Bioz Stars, 2026-03
    91/100 stars
      Buy from Supplier

    91
    Addgene inc mcherry pmcherry c1
    (a) Absorbance spectrum of the photosensitizers Rose Bengal dye (0.0026 mg/mL), <t>mCherry</t> (0.22 mg/mL), tdKillerRed (0.25 mg/mL), and SuperNova (0.76 mg/mL). See Table 1 for quantification.
    Mcherry Pmcherry C1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcherry pmcherry c1/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    mcherry pmcherry c1 - by Bioz Stars, 2026-03
    91/100 stars
      Buy from Supplier

    91
    Addgene inc cttcaactcttgccagaacaagagcaacaagactgccggagcatcgggagcctcaggagcatcgatgggttcagaggtcggccc supernova prsetb
    (a) Absorbance spectrum of the photosensitizers Rose Bengal dye (0.0026 mg/mL), <t>mCherry</t> (0.22 mg/mL), tdKillerRed (0.25 mg/mL), and SuperNova (0.76 mg/mL). See Table 1 for quantification.
    Cttcaactcttgccagaacaagagcaacaagactgccggagcatcgggagcctcaggagcatcgatgggttcagaggtcggccc Supernova Prsetb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cttcaactcttgccagaacaagagcaacaagactgccggagcatcgggagcctcaggagcatcgatgggttcagaggtcggccc supernova prsetb/product/Addgene inc
    Average 91 stars, based on 1 article reviews
    cttcaactcttgccagaacaagagcaacaagactgccggagcatcgggagcctcaggagcatcgatgggttcagaggtcggccc supernova prsetb - by Bioz Stars, 2026-03
    91/100 stars
      Buy from Supplier

    Image Search Results


    (a) Absorbance spectrum of the photosensitizers Rose Bengal dye (0.0026 mg/mL), mCherry (0.22 mg/mL), tdKillerRed (0.25 mg/mL), and SuperNova (0.76 mg/mL). See Table 1 for quantification.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: (a) Absorbance spectrum of the photosensitizers Rose Bengal dye (0.0026 mg/mL), mCherry (0.22 mg/mL), tdKillerRed (0.25 mg/mL), and SuperNova (0.76 mg/mL). See Table 1 for quantification.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques:

    Photosensitizer absorbance at 561 nm.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: Photosensitizer absorbance at 561 nm.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques:

    (a) Rose Bengal, (b) tdKillerRed, Supernova, mCherry and control (no photosensitizer) were irradiated with equal molar absorptivity at 561 nm in the presence of DHE (100 μM) for quantification of 2-OHE+. Values are mean ± SD for n = 3 independent experiments.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: (a) Rose Bengal, (b) tdKillerRed, Supernova, mCherry and control (no photosensitizer) were irradiated with equal molar absorptivity at 561 nm in the presence of DHE (100 μM) for quantification of 2-OHE+. Values are mean ± SD for n = 3 independent experiments.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques: Irradiation

    Superoxide and singlet oxygen quantum yield of  mCherry,  tdKillerRed, and SuperNova.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: Superoxide and singlet oxygen quantum yield of mCherry, tdKillerRed, and SuperNova.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques:

    (a) xanthine/xanthine oxidase (X/XO) O2•- production was assessed using cytochrome c reduction assay. Xanthine oxidase (XO, 4 mU/mL) and xanthine (X, 1 mM) were incubated with catalase (CAT) superoxide dismutase (SOD) where indicated. * p < 0.05 X/XO+SOD vs X/XO and vs X/XO+CAT, one-way ANOVA, Tukey post hoc. (b) Time course (0–60 min) of X/XO O2•- generation was measured using HPLC separation of 2-OHE+ and then plotted against the expected O2•- production. (c) Rose Bengal O2•- production rate per light dose. (d) Fluorescent protein (mCherry, tdKillerRed and SuperNova) O2•- production per light dose. Data from (c) and (d) are derived from data presented in Fig. 2. *p < 0.05 SuperNova vs mCherry, ** p < 0.05 SuperNova and tdKillerRed vs mCherry, two-way ANOVA, Bonferroni post hoc. Values are mean ± SD for n = 3 independent experiments.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: (a) xanthine/xanthine oxidase (X/XO) O2•- production was assessed using cytochrome c reduction assay. Xanthine oxidase (XO, 4 mU/mL) and xanthine (X, 1 mM) were incubated with catalase (CAT) superoxide dismutase (SOD) where indicated. * p < 0.05 X/XO+SOD vs X/XO and vs X/XO+CAT, one-way ANOVA, Tukey post hoc. (b) Time course (0–60 min) of X/XO O2•- generation was measured using HPLC separation of 2-OHE+ and then plotted against the expected O2•- production. (c) Rose Bengal O2•- production rate per light dose. (d) Fluorescent protein (mCherry, tdKillerRed and SuperNova) O2•- production per light dose. Data from (c) and (d) are derived from data presented in Fig. 2. *p < 0.05 SuperNova vs mCherry, ** p < 0.05 SuperNova and tdKillerRed vs mCherry, two-way ANOVA, Bonferroni post hoc. Values are mean ± SD for n = 3 independent experiments.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques: Incubation, Derivative Assay

    (a) Rose Bengal, (b) tdKillerRed, Supernova, mCherry and control (no photosensitizer) were irradiated with equal molar absorptivity at 561 nm in the presence of 0.1 μM SOSG. The initial fluorescence reading (Ex 525 nm; Em 550 nm) was subtracted from the post-illumination reading and presented as the relative fluorescence change. Values are mean ± SD for n = 3 independent experiments.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: (a) Rose Bengal, (b) tdKillerRed, Supernova, mCherry and control (no photosensitizer) were irradiated with equal molar absorptivity at 561 nm in the presence of 0.1 μM SOSG. The initial fluorescence reading (Ex 525 nm; Em 550 nm) was subtracted from the post-illumination reading and presented as the relative fluorescence change. Values are mean ± SD for n = 3 independent experiments.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques: Irradiation, Fluorescence

    Superoxide and singlet oxygen quantum yield of fluorescent proteins relative to tdKillerRed.

    Journal: Free radical biology & medicine

    Article Title: Quantification of reactive oxygen species production by the red fluorescent proteins KillerRed, SuperNova and mCherry.

    doi: 10.1016/j.freeradbiomed.2019.12.008

    Figure Lengend Snippet: Superoxide and singlet oxygen quantum yield of fluorescent proteins relative to tdKillerRed.

    Article Snippet: SuperNova/pRSETB was a gift from Dr. Takeharu Nagai (Addgene plasmid # 53234) [ 8 ]. mCherry (pmCherry-C1) and tdKillerRed (#FP963, Evrogen) were amplified and ligated into pRSETB using BamHI and EcoRI.

    Techniques: